Quotes About DNA

Having human DNA should not immediately grant an individual inalienable rights. Rights, it was decided, and equivalent responsibilities, should be given to 'citizens', and only those above a certain level of intelligence could become citizens. Protests did result when some humans failed to qualify, whilst all AIs and some particularly bright pigs did

There is no such thing as immortality: death is change. A human being is dying every day that it lives. The material of its body is exchanged for other materials, its thoughts change. All that lives is the DNA, and what does that matter to you? In the end it is your mind that is important.

There's as many atoms in a single molecule of your DNA as there are stars in the typical galaxy. We are, each of us, a little universe.

If a sample of soil is diluted, mixed with bacteria, and spread on agar, the phages will dot the culture with plaques after 24 hours of incubation. These plaques may be initiated by more than one phage, and the students engage in further rounds of isolation and bacterial infection to ensure that they have purified single phages. After many more steps in this lengthy procedure, the students purify and sequence the phage DNA, and can submit their sequences to an online database.

Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).

All life on our planet is related, and the readout of letters in DNA shows exactly how. By comparing DNA sequences, we can compute statistically how closely related we are to anything, from monkeys to marsupials, to reptiles, amphibians, fish, insects, crustaceans, worms, plants, protozoa, bacteria–you name it.

We are born with a seed of selfhood that contains the spiritual DNA of our uniqueness-an encoded birthright knowledge of who we are, why we are here, and how we are related to others. We may abandon that knowledge as the years go by, but it never abandons us.

That work led to the emergence of the recombinant DNA technology thereby providing a major tool for analyzing mammalian gene structure and function and formed the basis for me receiving the 1980 Nobel Prize in Chemistry.

The DNA of joy is gratitude.

As our knowledge of DNA expands, and our expertise in genetic manipulation increases, the concept of humanity may well become redundant.

we invented the concept back while your DNA was still trying to break free from mollusks.

Somos víctimas de nuestro ADN y punto.