Quotes About Recombinant

What the public needs to understand is that these new technologies, especially in recombinant DNA technology, allow scientists to bypass biological boundaries altogether.

What the public needs to understand is that these new technologies, especially in recombinant DNA technology, allow scientists to bypass biological boundaries altogether.

That work led to the emergence of the recombinant DNA technology thereby providing a major tool for analyzing mammalian gene structure and function and formed the basis for me receiving the 1980 Nobel Prize in Chemistry.

What we're most aware of in 'Eight-Legged Freaks' is how similar it is to other movies, a recombinant mutated species itself, the product of the crossbreeding of the suffering-from-gigantism movies of the 1950s and the 1990 B-picture classic 'Tremors.'

Here at the Cold Spring Harbor Laboratory, we have genetically rearranged various viruses and bacteria as part of our medical research. In fact, we have been able to create entirely new types of DNA molecules by splicing together the genetic information from different organisms - recombinant DNA.

Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).