logo

Quotes About Virus

But many other activities also called for greater independence, from home cooking, to home haircuts, to the performance of minor home repairs. Why risk having a plumber come over if he might have the virus?
~ Nicholas A. Christakis
The CDC defined a close contact of a person with coronavirus as someone who was "within 6 feet of an infected person for at least 15 minutes starting from 48 hours before illness onset until the time the patient is isolated." This is a somewhat arbitrary criterion, given that the virus can spread much farther than six feet.57
~ Nicholas A. Christakis
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).
~ Unknown
The dark was many things: the cold, the alien world, the virus, her own fear.
~ Nicola Griffith
Carmen kicked at the dirt. She couldn't equate finding the virus at home with good luck. It was powerful, this thing, ruthless, a perfectly honed survivor for who knew how many millennia. Perhaps it was old as life itself, a malevolent offshoot of the first sampling of creation. Yet Leigh and Daintith thought they could track it to its lair and swat it like some bothersome insect.
~ Unknown
The action of the virus is unique. It begins by attacking the respiratory system, the lining of the lungs and the bronchial in particular. The victim develops a cough, which serves to propagate the virus. Then it spreads to the other internal organs and the brain. We know of no other viral epidemic where the pattern of symptoms match this one. It's a virus that we've never seen before.
~ Unknown
In the early 1960s, when Maurice Hilleman wanted to make his vaccine, measles virus was killing eight million children in the world every year.
~ Paul A. Offit
At the start of the AIDS epidemic, American boys with hemophilia lived as long as those without the disease. By the end of the 1980s, among the ten thousand American males with severe hemophilia, nine thousand were infected with HIV. By 1994, more than 25 percent of the American hemophiliac population had died from AIDS. Most were children and adolescents.
~ Paul A. Offit
Maybe one day History will tell us that Ebola never won but rather Government's failed to act, and that Ebola just simply walked in and meet No resistance, Barring a few brave souls that fought the Virus on their own and never relied on the Government Coming to Help, the victor always writes the history what will Ebola write about Mankind
~ Paul Gilbert
Supply-side economics… is like one of those African viruses that, however often it may be eradicated from the settled areas, is always out there in the bush, waiting for new victims.
~ Paul Krugman
Indigenous people have been tracking the same 'psychic virus' for many centuries, calling it 'wetiko' in Cree (windigo in Ojibwa, wintiko in Powhatan), a term that refers to a biologically wicked person or spirit who terrorizes others by means of evil acts.
~ Unknown
Bad taste is a virus that gains strength as it spreads. People want to imitate it and outdo it.
~ Peggy Noonan
According to the Hill article, those heading up the Great Reset must follow the policies of "American Socialists" such as Senators Bernie Sanders and Alexandria Ocasio-Cortez and initiate the multi-trillion-dollar New Green Deal. It was the economic shutdowns during the virus that served as the motivation for this new order. The main purpose behind this radical agenda is to save the planet due to Climate Change.
~ Unknown