Quotes About Reprogramming
That's an unhealthy program I've been given from my childhood, from my social mirror. I don't like that ineffective script. I can change.
~ Stephen R. Covey
BazillionQuotes.com
Because we already live with many scripts that have been handed to us, the process of writing our own script is actually more a process of "rescripting," or paradigm shifting—of changing some of the basic paradigms that we already have.
~ Stephen R. Covey
BazillionQuotes.com
Viendo las cosas con la objetividad que da el tiempo, no andaban tan errados mis doctores ni tan mala era su fórmula. Al que está en guerra consigo mismo hay que aflojarle el yo obstinado. ¿Cómo? Muy simple. Puesto que el yo no es otra cosa que recuerdos, borrándole el recuerdo. Así la cinta queda lista para grabar de nuevo.
~ Fernando Vallejo
BazillionQuotes.com
I'm a massive believer in brands. Silicon Valley has tried to reprogram everybody to think brands aren't valuable. Or theirs are, but yours aren't.
~ Tim Armstrong
BazillionQuotes.com
Epigenetics is very important. We are keeping a close eye on iPS cells and other genetic methods of reprogramming the epigenome.
~ Liz Parrish
BazillionQuotes.com
Meditation should be the foremost technology of the 21st century; the technology of reprogramming the non-spatial universal computer.
~ Kedar Joshi
BazillionQuotes.com
Prayer is the way we communicate with God. Affirmation is the way we reprogram the mind.
~ Iyanla Vanzant
BazillionQuotes.com
I will program my mind to forbid itself from moving beyond its own reprogramming range.
~ Ted Chiang
BazillionQuotes.com
We're taught as a society what is acceptable for women to look like and what's not. And where fat should be and shouldn't. And I think it's important to sometimes reprogram ourselves and recondition ourselves to not have so much negativity toward our own bodies.
~ Kether Donohue
BazillionQuotes.com
I heard that if you complain it reprograms your brain like a computer virus and it just makes you more and more unhappy, so I'm going to stay positive because I bet the opposite is true, too.
~ Chuck Wendig
BazillionQuotes.com
heard that if you complain it reprograms your brain like a computer virus and it just makes you more and more unhappy, so I'm going to stay positive because I bet the opposite is true, too.
~ Chuck Wendig
BazillionQuotes.com
Negative programming. We write the programs. And we can rewrite the programs. If we drop the negative self- talk. If we drop the negative self- beliefs. If we drop the negative world view. Then we drop the negative programs. Think about the word negative. It refers to negative energy. What we put our energy into we create more of. Focusing on the negative is like praying for what we don't want. If we stop putting energy into what we don't want, then we stop creating it.
~ H.W. Mann
BazillionQuotes.com
I've spoken before on how the art of storytelling has been lost a bit. I definitely feel 'Empire' is helping to reprogram us back to that place where we pay attention and invest emotionally in the records and the artists.
~ Ne-Yo
BazillionQuotes.com
correctly reprogramming the brain is more than reminding yourself to think happy thoughts. I prefer that you adopt a mindset of "accurate thinking" with a positive or optimistic can-do spin to stay in the right frame of mind—happy. However, that's not easy to do because the default setting on the brain—set back in prehistoric times—is negativity.
~ Unknown
BazillionQuotes.com
Giving up an addiction means re-programming that part of your brain that makes you restless and unhappy if a desire is not realized.
~ Ken Keyes Jr.
BazillionQuotes.com
I welcome the opportunity (even if painful) that my minute to minute experience offers me to become aware of the addictions I must reprogram to be liberated from my robot-like emotional patterns.
~ Ken Keyes Jr.
BazillionQuotes.com
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).
~ Unknown
BazillionQuotes.com
You confuse our higher and lower functions, harnessing our drives and motivating us down an unnatural path, one in which human beings are reprogrammed to covet products and ignore reality.
~ Noah Hawley
BazillionQuotes.com
It's imperative to practice conscious, moment-by-moment awareness. Otherwise, you're operating out of old encrusted beliefs, beliefs you downloaded before you were five years old. Do you really want a five-year-old running your life?
~ Pam Grout
BazillionQuotes.com
