logo

Quotes About Singularity

Yet if we are to take the Lacanian account of singularity seriously, we must admit that what really counts in life is not our ability to evade chaos, but rather our capacity to meet it in such a manner as to not be irrevocably broken or demolished.
~ Unknown
Just be yourself because everybody else is taken.
~ Unknown
Being 'weird' is one of the most best complements you could ever give someone. If no one in the world was weird, everything would be normal, and that's boring. Be different. Stand out. Be the sore thumb that got hammered a couple times by a heavy mallet. Be that sole bird that's flying in the exact opposite direction everyone else is and hasn't a clue it's winter.
~ Unknown
For the first time, her singularity, the fact that she felt different from every person she knew, made sense to her, and she realized that no matter where she went in the world, she would have a point of view that no one else could possibly have.
~ Marisa Silver
Uniqueness isn't a virtue. It's a responsibility.
~ Mark Batterson
I was an infinitely hot and dense dot.
~ Mark Leyner
There's a perverse and bitter joy in feeling unique, but you pay dearly. Morrissey
~ Unknown
I believe in black holes. I believe that as the universe empties into nothingness, past and future will smack together in the last swirl around the drain.
~ Abraham Verghese
To be weird! That is my goal!
~ Alfred Jarry
Life and Jah are one in the same. Jah is the gift of existence. I am in some way eternal, I will never be duplicated. The singularity of every man and woman is Jah's gift. What we struggle to make of it is our sole gift to Jah. The process of what th.
~ Bob Marley
If [she] had come to prefer the company of odd ducks, it was possibly because they had no conception of oddity, or rather, they thought you were odd if you weren't.
~ Mary McCarthy
I am not sure I have ever met someone like you," I said. "That is good. What point would my life have, if there was a duplicate?
~ Matt Haig
I have no clan, nor any rank. I am unique.
~ Matt Wagner
We are human precisely insofar as we always intend a singularity across the thickness of our lives, insofar as we are grouped around this unique interior where there is no one, which is latent, veiled, and escapes from us always leaving behind in our hands truth which are like traces of its absence.
~ Maurice Merleau-Ponty
Just as there is an Ineinander of life and physiochemistry, i.e., the realization of life as a fold or a singularity of physiochemistry--or structure, so to is the human to be taken in the Ineinander with animality and Nature.
~ Maurice Merleau-Ponty
The intellectual is and only can be a militant, engaged as a singularity among others, embarked on the project of co-research aimed at making the multitude. The intellectual is thus not 'out in front' to determine the movements of history or 'on the sidelines' to critique them but rather completely 'inside.
~ Michael Hardt
The two that is one, The one that is all
~ Michael Scott
Computer scientists calculate that there have been thirty-two doublings since World War II, and that as early as 2030 we may encounter the singularity—the point at which total computational power will rise to levels that are so far beyond anything we can imagine that they will appear nearly infinite and thus, relatively speaking, be indistinguishable from omniscience.
~ Michael Shermer
La singularidad es parte de la creación de Dios.
~ Unknown
He is just different. That is all." She looked perplexed, but said, "Different is good. Different is wonderful.
~ Unknown
When we choose to be different, we have to expect a little attention.
~ Unknown
Nothing human makes it out of the near-future.
~ Unknown
Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).
~ Unknown
But she found herself drawn to Ivy because he wasn't like her at all, wasn't like anyone, really. Most people were different because they wanted to be noticed. ivy was different because he couldn't be anyone else
~ Unknown